circad | circRNAs associated with diseases

circ-ZEB1.33
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Hepatocellular Carcinoma (HCC)	ICD-10	#N/A (C22.0)
DBLink	Link to database	PMID	30123094
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	64 HCC patients and 30 cancer-free controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGACTCTCCTGAGAAGAA Reverse AAAGCCTCACTGAAAGGAAACA	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Gong, Y, Mao, J, Wu, D, Wang, X, Li, L, Zhu, L, Song, R (2018). Circ-ZEB1.33 promotes the proliferation of human HCC by sponging miR-200a-3p and upregulating CDK6. Cancer Cell Int., 18:116.